CALCULATE WITH CONFIDENCE

DNA, RNA & Protein

Six-Frame Complete Open-Reading-Frame Finder

Find every linear standard-code ATG-to-stop open reading frame across the three forward and three reverse-complement DNA frames, with exact input-strand coordinates and translations.

Biology · experimental measurements

Make the ORF definition, genetic code, strand, frame, minimum length and coordinate mapping explicit.

Private calculations in your browser · explicit inputs and model boundaries
Example preview · One forward ORFComplete ORFs retained in each DNA frame
Frame +11 ORFs
Frame +20 ORFs
Frame +30 ORFs
Frame -10 ORFs
Frame -20 ORFs
Frame -30 ORFs

Bars count ORFs meeting the 3-residue minimum. Reverse frames use the reverse complement and map back to entered-DNA coordinates.

  1. 1EnterProvide the known values
  2. 2CalculateResults update automatically
  3. 3VerifyReview the details and units
Try an example

Enter a whole number from 1 to 10,000.

Canonical A/C/G/T only; one raw or single-record FASTA sequence up to 30,000 bases.

Calculation result

—

Enter valid values to see the result.

Your entries are calculated in this browser and are not submitted to 365CALCS.COM.

Feedback

Understand the relationship

The reasoning behind the result

An ORF needs an explicit definition

ATG + n complete sense codons + in-frame stop

This workflow uses the start-to-stop definition rather than every stop-free interval.

Nested ATG starts are each retained when they share a downstream in-frame stop.

Double-stranded DNA has six reading frames

Three offsets are inspected on the entered 5′→3′ strand and three on its reverse complement.

Reverse-strand coordinates are mapped back to the entered sequence so the reported lower and upper positions remain auditable.

The genetic code and start rule are choices

The workflow uses NCBI standard code table 1, ATG as the sole start and TAA, TAG and TGA as stops.

Alternative genetic codes and initiation rules can change the candidate list.

An ORF is not a gene prediction

A start-to-stop string does not establish transcription, translation, exon structure, regulatory context or biological function.

Circular molecules and boundary-spanning ORFs require a different coordinate model.

Follow the numbers

Map one forward complete ORF

  1. Enter CCCATGGCTGCTGAATAAGG as linear DNA written 5′→3′.
  2. Inspect frame +1 from the first base, then +2 and +3 from their offsets.
  3. In frame +1, identify ATG and scan complete codons to the first in-frame TAA.
  4. Translate the sense codons with standard code table 1 and exclude the stop from residue count.
  5. Report input-strand coordinates spanning the ATG through all three stop bases.

The retained string satisfies the selected syntactic ORF definition; no gene or expression claim follows.

Quick guide

How to use this calculator

  1. Declare the record and organism context before applying the standard code.
  2. Set a minimum translated length appropriate to your separate analysis.
  3. Inspect strand, frame, input-strand coordinates, terminal stop and peptide for every retained ORF.

Calculation method

Calculation and interpretation

Make the ORF definition, genetic code, strand, frame, minimum length and coordinate mapping explicit.

In each of six frames, retain ATG starts that encounter a downstream in-frame TAA, TAG or TGA stop; translated length excludes the stop codon and nucleotide span includes it.

Worked example

Map one forward complete ORF

The retained string satisfies the selected syntactic ORF definition; no gene or expression claim follows.

In each of six frames, retain ATG starts that encounter a downstream in-frame TAA, TAG or TGA stop; translated length excludes the stop codon and nucleotide span includes it.

Supported inputs

Precision and limits

One linear exact DNA record

Canonical A/C/G/T input is required; ambiguity and circular boundary wrapping are excluded.

One genetic code

NCBI standard code table 1 is used with ATG-only initiation and three standard stops.

Complete ORFs only

Partial boundary ORFs and stop-to-stop intervals without a declared ATG are excluded.

No gene prediction

Splicing, promoters, ribosome binding, conservation, expression and function are not inferred.

Output support

Input is limited to 30,000 bases and 500 retained ORFs; raise the minimum length if the result is larger.

Continue calculating

Related calculators